Journal: Animals : an Open Access Journal from MDPI

Article Title: Genomic Characterization of the Istrian Shorthaired Hound

doi: 10.3390/ani10112013

Figure Lengend Snippet: Genomic regions with the highest iHS values.

Article Snippet: BICF2G630167445 , 4 , 36002909 , 4.374 , 4.915 , Upstream gene variant of the gene RGS14 (3,6 kbp), 5 prime UTR variant of LMAN2 , downstream variant of the gene F12 (4.9 kbp)..

Techniques: Variant Assay

Journal: Frontiers in Fungal Biology

Article Title: Genome-Wide Association for Itraconazole Sensitivity in Non-resistant Clinical Isolates of Aspergillus fumigatus

doi: 10.3389/ffunb.2020.617338

Figure Lengend Snippet: Characterization of SNPs associated with ITCZ sensitivity.

Article Snippet: 2 , 541570 , T , C , 0.00109 , 0.00231196 , Afu2g02170 , 5 prime UTR variant.

Techniques: Variant Assay

Journal: Scientific Reports

Article Title: Genetic predisposition to tinnitus in the UK Biobank population

doi: 10.1038/s41598-021-97350-z

Figure Lengend Snippet: Genome-wide association study results of tinnitus in the UK Biobank male and female cohorts. The −log 10 of each SNP’s p-values were recorded, mapped to their respective location on each chromosome, and plotted in male and female-specific Manhattan plots ( A , C ). Suggestive threshold is marked by the blue horizontal line at 1e−5, while the significance threshold is marked by the red horizontal line at 5e−8. In the male cohort, JAG2 , KRT4, SPATA31A1, KRT78, KRT79, APAF1 , PARGP1, CAMKK1, EHBP1, CTU1, SOX4, BAIAP2L2, and RASSF8 were all found to be suggestively implicated in cases of chronic tinnitus, while WDPCP was found to be significantly implicated in the female population. Q–Q plots for each data set denoting any bias, stratification, or linkage disequilibrium are also shown ( B , D ). The approximate slope of 1, combined with the provided genomic inflation factors, indicates that these factors were controlled for in both populations.

Article Snippet: rs190902899 , 6 , 21,594,474 , SOX4 , 5 prime UTR variant , - , 0.01336 , 4.27E−06 , 1.12E−01.

Techniques: GWAS

Journal: Scientific Reports

Article Title: Genetic predisposition to tinnitus in the UK Biobank population

doi: 10.1038/s41598-021-97350-z

Figure Lengend Snippet: Identified SNPs in male (rows 1-10) and female (rows 11-18) cohorts.

Article Snippet: rs190902899 , 6 , 21,594,474 , SOX4 , 5 prime UTR variant , - , 0.01336 , 4.27E−06 , 1.12E−01.

Techniques: Mutagenesis, Sequencing, Variant Assay

Journal: Nutrients

Article Title: Influence of Genetic Polymorphisms on Cognitive Function According to Dietary Exposure to Bisphenols in a Sample of Spanish Schoolchildren

doi: 10.3390/nu16162639

Figure Lengend Snippet: Information on the selected SNPs in the Spanish reference population (N = 107) and in our cohort (N = 102).

Article Snippet: BDNF , rs11030101 , chr11: 27659197 , A/T , 5 prime UTR variant , T: 0.435 (93) , T: 0.392 (80) , 0.264.

Techniques: Variant Assay

Journal: Nutrients

Article Title: Influence of Genetic Polymorphisms on Cognitive Function According to Dietary Exposure to Bisphenols in a Sample of Spanish Schoolchildren

doi: 10.3390/nu16162639

Figure Lengend Snippet: Scoring of each WISC-V index by genetic variant.

Article Snippet: BDNF , rs11030101 , chr11: 27659197 , A/T , 5 prime UTR variant , T: 0.435 (93) , T: 0.392 (80) , 0.264.

Techniques: Variant Assay

Journal: Nutrients

Article Title: Influence of Genetic Polymorphisms on Cognitive Function According to Dietary Exposure to Bisphenols in a Sample of Spanish Schoolchildren

doi: 10.3390/nu16162639

Figure Lengend Snippet: Fluid reasoning index scores obtained for ( A ) BDNF rs6265, ( B ) BDNF rs11030101, and ( C ) SNAP25 rs363039.

Article Snippet: BDNF , rs11030101 , chr11: 27659197 , A/T , 5 prime UTR variant , T: 0.435 (93) , T: 0.392 (80) , 0.264.

Techniques:

Journal: Nutrients

Article Title: Influence of Genetic Polymorphisms on Cognitive Function According to Dietary Exposure to Bisphenols in a Sample of Spanish Schoolchildren

doi: 10.3390/nu16162639

Figure Lengend Snippet: Influence of genetic polymorphisms on the cognitive profile assessed by WISC-V according to bisphenol exposure in children.

Article Snippet: BDNF , rs11030101 , chr11: 27659197 , A/T , 5 prime UTR variant , T: 0.435 (93) , T: 0.392 (80) , 0.264.

Techniques:

Journal: Scientific Reports

Article Title: Kernel machine SNP set analysis finds the association of BUD13, ZPR1, and APOA5 variants with metabolic syndrome in Tehran Cardio-metabolic Genetics Study

doi: 10.1038/s41598-021-89509-5

Figure Lengend Snippet: Characteristics of the Markers in selected chromosomal region.

Article Snippet: APOA5 , 5 prime UTR variant , rs651821 , 11:116791863 , T:C , 0.14 , 0.18 , C , 0.14.

Techniques: Variant Assay

Journal: Molecular Genetics & Genomic Medicine

Article Title: Association of NKX2‐5, GATA4, and TBX5 polymorphisms with congenital heart disease in Egyptian children

doi: 10.1002/mgg3.612

Figure Lengend Snippet: Primers sequence of the primers used for the polymerase chain reaction (PCR) Amplification of five single–nucleotide variants

Article Snippet: GATA4‐ (rs368418329) c.‐294G/T , 5‐prime UTR variant , gtgggttctgaaagctctgg , cctcggtgtcctctctctcc , 497 bp.

Techniques: Sequencing, Polymerase Chain Reaction, Amplification, Variant Assay

Journal: Molecular Genetics & Genomic Medicine

Article Title: Genetic polymorphisms analysis of pharmacogenomic VIP variants in Bai ethnic group from China

doi: 10.1002/mgg3.884

Figure Lengend Snippet: Basic Characteristics of the selected VIP variants from the PharmGKB database and genotype frequencies in Bai population

Article Snippet: rs3814055 , NR1I2 , 3 , 119,781,188 , Upstream variant 2KB, utr variant 5 prime , T , C , 0.32 , 0.68.

Techniques: Functional Assay, Variant Assay

Journal: PLoS ONE

Article Title: Using genome wide association studies to identify common QTL regions in three different genetic backgrounds based on Iberian pig breed

doi: 10.1371/journal.pone.0190184

Figure Lengend Snippet: Functional candidate genes identified in the common and specific QTL regions.

Article Snippet: rs318724354 , CSF1 , 5_prime_UTR_variant , M7.

Techniques: Functional Assay

Journal: PLoS ONE

Article Title: Using genome wide association studies to identify common QTL regions in three different genetic backgrounds based on Iberian pig breed

doi: 10.1371/journal.pone.0190184

Figure Lengend Snippet: Most relevant SNPs considered within selected candidate genes. dbSNP identification, gene name, predicted effect, QTL region.

Article Snippet: rs318724354 , CSF1 , 5_prime_UTR_variant , M7.

Techniques:

Journal: Genes

Article Title: Association between SNPs in Leptin Pathway Genes and Anthropometric, Biochemical, and Dietary Markers Related to Obesity

doi: 10.3390/genes13060945

Figure Lengend Snippet: List of 74 genetic variants evaluated in the study.

Article Snippet: rs34114122 , T > G , 5 prime UTR variant.

Techniques: Variant Assay, Functional Assay, Sequencing

Journal: Genes

Article Title: Association between SNPs in Leptin Pathway Genes and Anthropometric, Biochemical, and Dietary Markers Related to Obesity

doi: 10.3390/genes13060945

Figure Lengend Snippet: Genetic frequencies of evaluated variants.

Article Snippet: rs34114122 , T > G , 5 prime UTR variant.

Techniques:

Journal: Genes

Article Title: Association between SNPs in Leptin Pathway Genes and Anthropometric, Biochemical, and Dietary Markers Related to Obesity

doi: 10.3390/genes13060945

Figure Lengend Snippet: Significant statistical associations between clinical markers of obesity and SNPs of LEP, LEPR, POMC, PCSK1, and MC4R, considered to be risk factors.

Article Snippet: rs34114122 , T > G , 5 prime UTR variant.

Techniques: Marker, Fat